Barcoding Life

Updated: Aug 6, 2024
ACCCTTTATTTAGTATTTGGCGCCTGAGCTGGAATAGTCGGGACTGCCCTGAGCCTCCTTATCCGAGCAGAGCTTAGCCAACCAGGCGCACTGCTAGGGGATGACCAGATCTATAATGTAATTGTTACAGCCCACGCCTTCGTAATAATCTTTTTTATAGTTATGCCCATCATGATTGGCGGTTTTGGAAACTGACTCATTCCCCTTATAATCGGAGCCCCCGACATAGCATTCCCTCGAATGAACAACATGAGCTTTTGGCTTCTCCCACCATCCTTTCTTCTTCTGCTTGCCTCATCAGGCGTAGAAGCTGGAGCAGGGACGGGATGAACAGTTTACCCCCCGCTAGCCGGGAATTTGGCCCATGCAGGAGCTTCCGTCGACTTAACAATCTTTTCGTTACACCTTGCAGGGATCTCTTCGATCCTAGGAGCTATTAATTTTATCACAACAATTATTAATATAAAACCCCCTGCTATTTCGCAATATCAGACACCTCTATTTGTGTGGGCTGTTCTAATTACCGCGGTTCTTCTGTTATTGTCCCTTCCCGTTCTTGCTGCTGGGATCACGATGCTCCTGACAGATCGTAATCTAAATACCACATTTTTTGACCCCGCAGGCGGAGGTGACCCAATTCTTTATCAACACTTA
The letters you see above — A's, C's, G's, and T's — match the colorful picture just below them. These letters form a DNA sequence that is unique to one species of plant or animal. Each species has its own different sequence at this particular spot in their DNA. Scientists call this sequence piece a "DNA barcode."
DNA barcoding uses a small piece of an organism's DNA to figure out which species it belongs to — like how a store uses barcodes to keep track of all the different items for sale. DNA barcodes are an important tool in efforts to make a list of all the different plants and animals in the world. The process started in Guelph, Ontario, Canada, and scientists there continue to lead this effort around the world.
One way scientists use DNA barcoding is in conservation biology — which works to study and protect plants and animals so they don't disappear forever. And part of this is helping us think about how we as people affect our environment.
These DNA codes also tell stories about species' history — both shared and unique. Similar letters in DNA show where species have a shared history, and different combinations of letters show their unique histories. Through DNA barcodes, we can see how even places that are far apart are connected by the global web of life.



Comments